Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 106422
• Name: oriT_Java9|p4
• Organism: Yersinia pestis strain Java9
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP009992 (7024..7083 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_Java9|p4
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 6859
• GenBank: NZ_CP009992
• Plasmid name: Java9|p4
• Incompatibility group: ColRNAI
• Plasmid size: 9670 bp
• Coordinate of oriT [Strand]: 7024..7083 [-]
• Host baterium: Yersinia pestis strain Java9

Cargo genes

• Drug resistance gene: -
• Virulence gene: pla
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -