Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106404
Name   oriT_VRMSSA-WC113|unnamed in_silico
Organism   Staphylococcus aureus strain VRMSSA-WC113
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP092543 (1284..1523 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 155..160, 164..169  (TCTGGC..GCCAGA)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_VRMSSA-WC113|unnamed
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6841 GenBank   NZ_CP092543
Plasmid name   VRMSSA-WC113|unnamed Incompatibility group   -
Plasmid size   24653 bp Coordinate of oriT [Strand]   1284..1523 [+]
Host baterium   Staphylococcus aureus strain VRMSSA-WC113

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21