Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106401
Name   oriT_p20ES-10 in_silico
Organism   Enterobacter cloacae strain 20ES
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM008915 (5076..5135 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p20ES-10
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6838 GenBank   NZ_CM008915
Plasmid name   p20ES-10 Incompatibility group   ColRNAI
Plasmid size   5881 bp Coordinate of oriT [Strand]   5076..5135 [-]
Host baterium   Enterobacter cloacae strain 20ES

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -