Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106383 |
| Name | oriT1_p7209-15  |
| Organism | Serratia marcescens strain 7209 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM008886 ( 11147..11206 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT1_p7209-15
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6820 | GenBank | NZ_CM008886 |
| Plasmid name | p7209-15 | Incompatibility group | Col440II |
| Plasmid size | 11781 bp | Coordinate of oriT [Strand] | 5253..5312 [+]; 11147..11206 [+] |
| Host baterium | Serratia marcescens strain 7209 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |