Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106381 |
| Name | oriT_p14ES-6400  |
| Organism | Serratia marcescens strain 14ES |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM008883 (1144..1201 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p14ES-6400
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6818 | GenBank | NZ_CM008883 |
| Plasmid name | p14ES-6400 | Incompatibility group | ColRNAI |
| Plasmid size | 3221 bp | Coordinate of oriT [Strand] | 1144..1201 [-] |
| Host baterium | Serratia marcescens strain 14ES |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |