Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106381
Name   oriT_p14ES-6400 in_silico
Organism   Serratia marcescens strain 14ES
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM008883 (1144..1201 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_p14ES-6400
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6818 GenBank   NZ_CM008883
Plasmid name   p14ES-6400 Incompatibility group   ColRNAI
Plasmid size   3221 bp Coordinate of oriT [Strand]   1144..1201 [-]
Host baterium   Serratia marcescens strain 14ES

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -