Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106376 |
| Name | oriT1_p3107E  |
| Organism | Lactococcus cremoris strain 3107 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP031543 ( 7590..7726 [+], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT1_p3107E
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6813 | GenBank | NZ_CP031543 |
| Plasmid name | p3107E | Incompatibility group | - |
| Plasmid size | 18170 bp | Coordinate of oriT [Strand] | 14011..14147 [-]; 7590..7726 [+] |
| Host baterium | Lactococcus cremoris strain 3107 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |