Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 106368
• Name: oriT_P048595|unnamed3
• Organism: Salmonella enterica strain P048595
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP093389 (1..65 [-], 65 nt)
• oriT length: 65 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 65 nt

>oriT_P048595|unnamed3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 6805
• GenBank: NZ_CP093389
• Plasmid name: P048595|unnamed3
• Incompatibility group: ColRNAI
• Plasmid size: 3176 bp
• Coordinate of oriT [Strand]: 1..65 [-]
• Host baterium: Salmonella enterica strain P048595

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -