Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106368
Name   oriT_P048595|unnamed3 in_silico
Organism   Salmonella enterica strain P048595
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP093389 (1..65 [-], 65 nt)
oriT length   65 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 65 nt

>oriT_P048595|unnamed3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6805 GenBank   NZ_CP093389
Plasmid name   P048595|unnamed3 Incompatibility group   ColRNAI
Plasmid size   3176 bp Coordinate of oriT [Strand]   1..65 [-]
Host baterium   Salmonella enterica strain P048595

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -