Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106362 |
| Name | oriT_pR19.0144_2.2k  |
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R19.0144 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP093410 (1202..1282 [+], 81 nt) |
| oriT length | 81 nt |
| IRs (inverted repeats) | 42..47, 50..55 (CGTCGC..GCGACG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 81 nt
>oriT_pR19.0144_2.2k
GGGTGTCGGGGCGCAGCCCTGACCAGGGGTAATTGTGATAGCGTCGCGTGCGACGGTATTACAATTACACATCCTGTCCCG
GGGTGTCGGGGCGCAGCCCTGACCAGGGGTAATTGTGATAGCGTCGCGTGCGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6799 | GenBank | NZ_CP093410 |
| Plasmid name | pR19.0144_2.2k | Incompatibility group | - |
| Plasmid size | 2228 bp | Coordinate of oriT [Strand] | 1202..1282 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Agona strain R19.0144 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |