Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106354 |
| Name | oriT_FL-8|unnamed1  |
| Organism | Lactiplantibacillus paraplantarum strain FL-8 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP118746 (3530..3666 [-], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGCA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_FL-8|unnamed1
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGCATTTATGGTTTTATATGGTCCATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGCATTTATGGTTTTATATGGTCCATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6791 | GenBank | NZ_CP118746 |
| Plasmid name | FL-8|unnamed1 | Incompatibility group | - |
| Plasmid size | 8916 bp | Coordinate of oriT [Strand] | 3530..3666 [-] |
| Host baterium | Lactiplantibacillus paraplantarum strain FL-8 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |