Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106333
Name   oriT_158900|unnamed1 in_silico
Organism   Salmonella enterica subsp. enterica serovar Java strain 158900
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM019080 (4570..4629 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_158900|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6770 GenBank   NZ_CM019080
Plasmid name   158900|unnamed1 Incompatibility group   ColRNAI
Plasmid size   6058 bp Coordinate of oriT [Strand]   4570..4629 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Java strain 158900

Cargo genes


Drug resistance gene   sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -