Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106322
Name   oriT_pR22.0044_6k in_silico
Organism   Salmonella enterica subsp. enterica serovar Infantis strain R22.0044
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP121072 (3599..3759 [-], 161 nt)
oriT length   161 nt
IRs (inverted repeats)      40..45, 49..54  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 161 nt

>oriT_pR22.0044_6k
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6759 GenBank   NZ_CP121072
Plasmid name   pR22.0044_6k Incompatibility group   IncQ1
Plasmid size   6477 bp Coordinate of oriT [Strand]   3599..3759 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Infantis strain R22.0044

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -