Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106291
Name   oriT_164132|unnamed in_silico
Organism   Salmonella enterica subsp. enterica serovar Kentucky strain 164132
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM019097 (1335..1394 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_164132|unnamed
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6728 GenBank   NZ_CM019097
Plasmid name   164132|unnamed Incompatibility group   ColRNAI
Plasmid size   4593 bp Coordinate of oriT [Strand]   1335..1394 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Kentucky strain 164132

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -