Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106280
Name   oriT1_pFORC61_2 in_silico
Organism   Staphylococcus aureus strain FORC_061
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP022608 ( 10434..10672 [-], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      216..221, 231..236  (ATTTTA..TAAAAT)
 153..159, 163..169  (GTCTGGC..GCCAGAC)
 24..31, 43..50  (CTTTTTTA..TAAAAAAG)
 36..41, 44..49  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT1_pFORC61_2
AAGACATTAGTGATGACTGATGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6717 GenBank   NZ_CP022608
Plasmid name   pFORC61_2 Incompatibility group   -
Plasmid size   17939 bp Coordinate of oriT [Strand]   7401..7639 [+]; 10434..10672 [-]
Host baterium   Staphylococcus aureus strain FORC_061

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21