Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 106276 |
Name | oriT_pSC2020597_5k |
Organism | Salmonella enterica strain SC2020597 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP120673 (1746..1802 [-], 57 nt) |
oriT length | 57 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSC2020597_5k
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAACGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAACGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 6713 | GenBank | NZ_CP120673 |
Plasmid name | pSC2020597_5k | Incompatibility group | Col440I |
Plasmid size | 5754 bp | Coordinate of oriT [Strand] | 1746..1802 [-] |
Host baterium | Salmonella enterica strain SC2020597 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |