Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106276 |
| Name | oriT_pSC2020597_5k  |
| Organism | Salmonella enterica strain SC2020597 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120673 (1746..1802 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSC2020597_5k
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAACGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAACGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6713 | GenBank | NZ_CP120673 |
| Plasmid name | pSC2020597_5k | Incompatibility group | Col440I |
| Plasmid size | 5754 bp | Coordinate of oriT [Strand] | 1746..1802 [-] |
| Host baterium | Salmonella enterica strain SC2020597 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |