Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106267 |
| Name | oriT_PRO116|unnamed7  |
| Organism | Priestia flexa strain PRO116 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120597 (2235..2274 [+], 40 nt) |
| oriT length | 40 nt |
| IRs (inverted repeats) | 14..19, 30..35 (AAAGTA..TACTTT) 2..8, 12..18 (ACTTTTG..CAAAAGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 40 nt
>oriT_PRO116|unnamed7
CACTTTTGGAACAAAAGTATAGTGTGCTCTACTTTACATG
CACTTTTGGAACAAAAGTATAGTGTGCTCTACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6704 | GenBank | NZ_CP120597 |
| Plasmid name | PRO116|unnamed7 | Incompatibility group | - |
| Plasmid size | 4472 bp | Coordinate of oriT [Strand] | 2235..2274 [+] |
| Host baterium | Priestia flexa strain PRO116 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |