Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106249 |
| Name | oriT_pRWS292.s8 |
| Organism | Klebsiella pneumoniae strain WS_29-2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP110531 (2386..2437 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 6..14, 17..25 (CGCAAAATT..AATTTTGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pRWS292.s8
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6686 | GenBank | NZ_CP110531 |
| Plasmid name | pRWS292.s8 | Incompatibility group | ColRNAI |
| Plasmid size | 3347 bp | Coordinate of oriT [Strand] | 2386..2437 [+] |
| Host baterium | Klebsiella pneumoniae strain WS_29-2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |