Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106230 |
| Name | oriT1_pKP57-3  |
| Organism | Klebsiella pneumoniae strain 57 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP088127 (14358..14455 [+], 98 nt) |
| oriT length | 98 nt |
| IRs (inverted repeats) | 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 98 nt
>oriT1_pKP57-3
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6667 | GenBank | NZ_CP088127 |
| Plasmid name | pKP57-3 | Incompatibility group | IncR |
| Plasmid size | 83070 bp | Coordinate of oriT [Strand] | 14358..14455 [+]; 76815..76913 [+] |
| Host baterium | Klebsiella pneumoniae strain 57 |
Cargo genes
| Drug resistance gene | sul2, aph(3'')-Ib, aph(6)-Id, aph(3')-Ia, aac(3)-IId, aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, sul1, mph(A), tet(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |