Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106213 |
| Name | oriT_pSW25H03  |
| Organism | Klebsiella pneumoniae strain AHSWKP25 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091055 (1508..1557 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pSW25H03
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6650 | GenBank | NZ_CP091055 |
| Plasmid name | pSW25H03 | Incompatibility group | - |
| Plasmid size | 2667 bp | Coordinate of oriT [Strand] | 1508..1557 [+] |
| Host baterium | Klebsiella pneumoniae strain AHSWKP25 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |