Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106182
Name   oriT_p.S175-1.1 in_silico
Organism   Citrobacter cronae strain S175-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060442 (1531..1590 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p.S175-1.1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6619 GenBank   NZ_CP060442
Plasmid name   p.S175-1.1 Incompatibility group   ColRNAI
Plasmid size   5503 bp Coordinate of oriT [Strand]   1531..1590 [-]
Host baterium   Citrobacter cronae strain S175-1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -