Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106118
Name   oriT_p805-3 in_silico
Organism   Salmonella enterica strain 805
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060842 (914..1197 [-], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      184..189, 197..202  (ATAAAA..TTTTAT)
 119..125, 139..145  (GCGGTGT..ACACCGC)
 31..37, 42..48  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_p805-3
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTTCTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACACCGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGATGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6555 GenBank   NZ_CP060842
Plasmid name   p805-3 Incompatibility group   ColRNAI
Plasmid size   6432 bp Coordinate of oriT [Strand]   914..1197 [-]
Host baterium   Salmonella enterica strain 805

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -