Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106116
Name   oriT_p1505-3 in_silico
Organism   Salmonella enterica strain 1505
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060836 (4207..4266 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p1505-3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6553 GenBank   NZ_CP060836
Plasmid name   p1505-3 Incompatibility group   Col440I
Plasmid size   4267 bp Coordinate of oriT [Strand]   4207..4266 [+]
Host baterium   Salmonella enterica strain 1505

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -