Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106091
Name   oriT_pD_F11 in_silico
Organism   Klebsiella pneumoniae strain F11
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP092905 (1208..1258 [-], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_pD_F11
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6528 GenBank   NZ_CP092905
Plasmid name   pD_F11 Incompatibility group   ColRNAI
Plasmid size   2927 bp Coordinate of oriT [Strand]   1208..1258 [-]
Host baterium   Klebsiella pneumoniae strain F11

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -