Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106076
Name   oriT_pSB1-57-b in_silico
Organism   Staphylococcus sp. SB1-57
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP070966 (6229..6335 [-], 107 nt)
oriT length   107 nt
IRs (inverted repeats)      39..45, 49..55  (TTGGGGA..TCCCCAA)
 10..17, 21..28  (ATTTTTTC..GAAAAAAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 107 nt

>oriT_pSB1-57-b
TAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAGTGCTTGCCAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6513 GenBank   NZ_CP070966
Plasmid name   pSB1-57-b Incompatibility group   -
Plasmid size   6335 bp Coordinate of oriT [Strand]   6229..6335 [-]
Host baterium   Staphylococcus sp. SB1-57

Cargo genes


Drug resistance gene   vga(A)LC
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -