Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106076 |
| Name | oriT_pSB1-57-b  |
| Organism | Staphylococcus sp. SB1-57 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP070966 (6229..6335 [-], 107 nt) |
| oriT length | 107 nt |
| IRs (inverted repeats) | 39..45, 49..55 (TTGGGGA..TCCCCAA) 10..17, 21..28 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 107 nt
>oriT_pSB1-57-b
TAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAGTGCTTGCCAAA
TAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAGTGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6513 | GenBank | NZ_CP070966 |
| Plasmid name | pSB1-57-b | Incompatibility group | - |
| Plasmid size | 6335 bp | Coordinate of oriT [Strand] | 6229..6335 [-] |
| Host baterium | Staphylococcus sp. SB1-57 |
Cargo genes
| Drug resistance gene | vga(A)LC |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |