Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 106067 |
Name | oriT_CR-hvKP005|unnamed2 |
Organism | Klebsiella pneumoniae strain CR-hvKP005 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP119016 (4532..4589 [+], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_CR-hvKP005|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 6504 | GenBank | NZ_CP119016 |
Plasmid name | CR-hvKP005|unnamed2 | Incompatibility group | ColRNAI |
Plasmid size | 5596 bp | Coordinate of oriT [Strand] | 4532..4589 [+] |
Host baterium | Klebsiella pneumoniae strain CR-hvKP005 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |