Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106058 |
| Name | oriT1_pIM029_KPC  |
| Organism | Klebsiella pneumoniae strain IM029 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP095427 ( 4007..4130 [-], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT1_pIM029_KPC
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6495 | GenBank | NZ_CP095427 |
| Plasmid name | pIM029_KPC | Incompatibility group | IncFII |
| Plasmid size | 120647 bp | Coordinate of oriT [Strand] | 119237..119360 [-]; 4007..4130 [-] |
| Host baterium | Klebsiella pneumoniae strain IM029 |
Cargo genes
| Drug resistance gene | rmtB, fosA3, blaKPC-2, blaSHV-12 |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |