Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106053 |
| Name | oriT_pIM007_vir  |
| Organism | Klebsiella pneumoniae strain IM007 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP095429 (178999..179026 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_pIM007_vir
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6490 | GenBank | NZ_CP095429 |
| Plasmid name | pIM007_vir | Incompatibility group | IncFIB |
| Plasmid size | 228102 bp | Coordinate of oriT [Strand] | 178999..179026 [-] |
| Host baterium | Klebsiella pneumoniae strain IM007 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iroD, iroC, iroB, iucA, iucB, iucC, iutA |
| Metal resistance gene | pbrA, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, terW, terZ, terA, terB, terC, terD, terE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |