Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105992 |
Name | oriT_pRHB41-C20_6 |
Organism | Escherichia fergusonii strain RHB41-C20 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP056966 (1071..1157 [+], 87 nt) |
oriT length | 87 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_pRHB41-C20_6
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 6429 | GenBank | NZ_CP056966 |
Plasmid name | pRHB41-C20_6 | Incompatibility group | Col |
Plasmid size | 1553 bp | Coordinate of oriT [Strand] | 1071..1157 [+] |
Host baterium | Escherichia fergusonii strain RHB41-C20 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |