Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105989
Name   oriT_pRHB32-C09_5 in_silico
Organism   Escherichia fergusonii strain RHB32-C09
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP057242 (1070..1162 [+], 93 nt)
oriT length   93 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 93 nt

>oriT_pRHB32-C09_5
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTTGGGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6426 GenBank   NZ_CP057242
Plasmid name   pRHB32-C09_5 Incompatibility group   Col
Plasmid size   1551 bp Coordinate of oriT [Strand]   1070..1162 [+]
Host baterium   Escherichia fergusonii strain RHB32-C09

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -