Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105983
Name   oriT_pRHBSTW-00433_8 in_silico
Organism   Klebsiella pneumoniae strain RHBSTW-00433
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056537 (3054..3113 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00433_8
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6420 GenBank   NZ_CP056537
Plasmid name   pRHBSTW-00433_8 Incompatibility group   Col440II
Plasmid size   4772 bp Coordinate of oriT [Strand]   3054..3113 [+]
Host baterium   Klebsiella pneumoniae strain RHBSTW-00433

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -