Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105976 |
| Name | oriT_pRHBSTW-00310_3 |
| Organism | Citrobacter freundii strain RHBSTW-00310 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056624 (108096..108145 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00310_3
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 107538..133160
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HV151_RS27290 | 102662..102907 | - | 246 | WP_306453680 | hypothetical protein | - |
| HV151_RS26660 (HV151_26665) | 102889..103869 | - | 981 | WP_000019445 | IS5-like element ISKpn26 family transposase | - |
| HV151_RS26665 (HV151_26670) | 103962..104174 | + | 213 | WP_019706020 | hypothetical protein | - |
| HV151_RS26670 (HV151_26675) | 104185..104409 | + | 225 | WP_014343499 | hypothetical protein | - |
| HV151_RS26675 (HV151_26680) | 104490..104810 | + | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| HV151_RS26680 (HV151_26685) | 104800..105078 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| HV151_RS26685 (HV151_26690) | 105079..105492 | + | 414 | WP_023287139 | helix-turn-helix domain-containing protein | - |
| HV151_RS26690 (HV151_26695) | 106322..107143 | + | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| HV151_RS26695 (HV151_26700) | 107176..107505 | + | 330 | WP_047066474 | DUF5983 family protein | - |
| HV151_RS26700 (HV151_26705) | 107538..108023 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| HV151_RS26705 (HV151_26710) | 108414..108830 | + | 417 | WP_072145360 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| HV151_RS26710 (HV151_26715) | 109030..109749 | + | 720 | WP_015065526 | hypothetical protein | - |
| HV151_RS26715 (HV151_26720) | 109882..110085 | + | 204 | WP_171486139 | TraY domain-containing protein | - |
| HV151_RS26720 (HV151_26725) | 110150..110518 | + | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| HV151_RS26725 (HV151_26730) | 110532..110837 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| HV151_RS26730 (HV151_26735) | 110857..111423 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| HV151_RS26735 (HV151_26740) | 111410..112150 | + | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| HV151_RS26740 (HV151_26745) | 112150..113574 | + | 1425 | WP_015065626 | F-type conjugal transfer pilus assembly protein TraB | traB |
| HV151_RS26745 (HV151_26750) | 113648..114232 | + | 585 | WP_020277945 | type IV conjugative transfer system lipoprotein TraV | traV |
| HV151_RS27210 | 114387..114785 | + | 399 | WP_020277946 | hypothetical protein | - |
| HV151_RS27215 | 114856..115104 | + | 249 | WP_223175793 | hypothetical protein | - |
| HV151_RS26755 (HV151_26760) | 115128..115346 | + | 219 | WP_004195468 | hypothetical protein | - |
| HV151_RS26760 (HV151_26765) | 115347..115658 | + | 312 | WP_047066479 | hypothetical protein | - |
| HV151_RS26765 (HV151_26770) | 115725..116129 | + | 405 | WP_004197817 | hypothetical protein | - |
| HV151_RS26770 (HV151_26775) | 116505..116903 | + | 399 | WP_023179972 | hypothetical protein | - |
| HV151_RS26775 (HV151_26780) | 116975..119614 | + | 2640 | WP_191225830 | type IV secretion system protein TraC | virb4 |
| HV151_RS26780 (HV151_26785) | 119614..120003 | + | 390 | WP_032736784 | type-F conjugative transfer system protein TrbI | - |
| HV151_RS26785 (HV151_26790) | 120003..120629 | + | 627 | WP_020277949 | type-F conjugative transfer system protein TraW | traW |
| HV151_RS26790 (HV151_26795) | 120671..121060 | + | 390 | WP_020277950 | hypothetical protein | - |
| HV151_RS26795 (HV151_26800) | 121057..122046 | + | 990 | WP_009309872 | conjugal transfer pilus assembly protein TraU | traU |
| HV151_RS26800 (HV151_26805) | 122059..122697 | + | 639 | WP_015065635 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| HV151_RS26805 (HV151_26810) | 122756..124711 | + | 1956 | WP_020277951 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| HV151_RS26810 (HV151_26815) | 124743..124997 | + | 255 | WP_049194392 | conjugal transfer protein TrbE | - |
| HV151_RS26815 (HV151_26820) | 124975..125223 | + | 249 | WP_004152675 | hypothetical protein | - |
| HV151_RS26820 (HV151_26825) | 125236..125562 | + | 327 | WP_004144402 | hypothetical protein | - |
| HV151_RS26825 (HV151_26830) | 125583..126335 | + | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| HV151_RS26830 (HV151_26835) | 126346..126585 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| HV151_RS26835 (HV151_26840) | 126557..127114 | + | 558 | WP_032736782 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| HV151_RS26840 (HV151_26845) | 127160..127405 | + | 246 | Protein_170 | conjugal transfer protein TrbF | - |
| HV151_RS26845 (HV151_26850) | 127490..128697 | + | 1208 | WP_097311113 | IS3 family transposase | - |
| HV151_RS26850 (HV151_26855) | 128736..128954 | + | 219 | Protein_172 | conjugal transfer protein TrbF | - |
| HV151_RS26855 (HV151_26860) | 128932..130311 | + | 1380 | WP_191225831 | conjugal transfer pilus assembly protein TraH | traH |
| HV151_RS26860 (HV151_26865) | 130311..133160 | + | 2850 | WP_020277954 | conjugal transfer mating-pair stabilization protein TraG | traG |
| HV151_RS26865 (HV151_26870) | 133163..133696 | + | 534 | WP_014343486 | conjugal transfer protein TraS | - |
| HV151_RS26870 (HV151_26875) | 133882..134613 | + | 732 | WP_004152629 | conjugal transfer complement resistance protein TraT | - |
| HV151_RS26875 (HV151_26880) | 134806..135495 | + | 690 | WP_014343485 | hypothetical protein | - |
| HV151_RS26880 (HV151_26885) | 135622..136152 | + | 531 | Protein_178 | TraD N-terminal domain-containing protein | - |
| HV151_RS26885 (HV151_26890) | 136185..136790 | - | 606 | WP_000509966 | recombinase family protein | - |
Host bacterium
| ID | 6413 | GenBank | NZ_CP056624 |
| Plasmid name | pRHBSTW-00310_3 | Incompatibility group | IncFII |
| Plasmid size | 152768 bp | Coordinate of oriT [Strand] | 108096..108145 [-] |
| Host baterium | Citrobacter freundii strain RHBSTW-00310 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |