Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105967 |
| Name | oriT_pRHBSTW-00486_4  |
| Organism | Citrobacter freundii strain RHBSTW-00486 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056469 (925..1108 [+], 184 nt) |
| oriT length | 184 nt |
| IRs (inverted repeats) | 106..111, 116..121 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 184 nt
>oriT_pRHBSTW-00486_4
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6404 | GenBank | NZ_CP056469 |
| Plasmid name | pRHBSTW-00486_4 | Incompatibility group | Col |
| Plasmid size | 2349 bp | Coordinate of oriT [Strand] | 925..1108 [+] |
| Host baterium | Citrobacter freundii strain RHBSTW-00486 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |