Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105949
Name   oriT_CIP_106347|unnamed1 in_silico
Organism   Shigella sonnei strain CIP_106347
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP109777 (6775..6834 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_CIP_106347|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6386 GenBank   NZ_CP109777
Plasmid name   CIP_106347|unnamed1 Incompatibility group   ColRNAI
Plasmid size   8401 bp Coordinate of oriT [Strand]   6775..6834 [+]
Host baterium   Shigella sonnei strain CIP_106347

Cargo genes


Drug resistance gene   aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -