Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105947 |
| Name | oriT_pBP-33.4  |
| Organism | Bacillus safensis strain 33.4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP106653 (6125..6146 [+], 22 nt) |
| oriT length | 22 nt |
| IRs (inverted repeats) | 2..7, 16..21 (CCCCCC..GGGGGG) 1..6, 16..21 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 22 nt
>oriT_pBP-33.4
CCCCCCCAGCTAACAGGGGGGT
CCCCCCCAGCTAACAGGGGGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6384 | GenBank | NZ_CP106653 |
| Plasmid name | pBP-33.4 | Incompatibility group | - |
| Plasmid size | 7753 bp | Coordinate of oriT [Strand] | 6125..6146 [+] |
| Host baterium | Bacillus safensis strain 33.4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |