Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105936 |
| Name | oriT_pCF10-H  |
| Organism | Citrobacter youngae strain CF10 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102508 (778..837 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pCF10-H
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6373 | GenBank | NZ_CP102508 |
| Plasmid name | pCF10-H | Incompatibility group | ColRNAI |
| Plasmid size | 5411 bp | Coordinate of oriT [Strand] | 778..837 [-] |
| Host baterium | Citrobacter youngae strain CF10 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |