Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105925 |
| Name | oriT_pA17C  |
| Organism | Ligilactobacillus salivarius strain VHProbi A17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP097168 (768..819 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 14..19, 26..31 (TCCCAC..GTGGGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pA17C
TGATACTATCGGCTCCCACGCACCTGTGGGACCATTTTCTCTTATGCTCTTT
TGATACTATCGGCTCCCACGCACCTGTGGGACCATTTTCTCTTATGCTCTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6362 | GenBank | NZ_CP097168 |
| Plasmid name | pA17C | Incompatibility group | - |
| Plasmid size | 3349 bp | Coordinate of oriT [Strand] | 768..819 [+] |
| Host baterium | Ligilactobacillus salivarius strain VHProbi A17 |
Cargo genes
| Drug resistance gene | lnu(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |