Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105898
Name   oriT_pFJMB80144_2 in_silico
Organism   Enterobacter hormaechei strain FUJ80144
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP025857 (1096..1155 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pFJMB80144_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6335 GenBank   NZ_AP025857
Plasmid name   pFJMB80144_2 Incompatibility group   Col440II
Plasmid size   4760 bp Coordinate of oriT [Strand]   1096..1155 [+]
Host baterium   Enterobacter hormaechei strain FUJ80144

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -