Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105871
Name   oriT_pFJMB80153_2 in_silico
Organism   Enterobacter hormaechei strain FUJ80153
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP025877 (898..957 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pFJMB80153_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6308 GenBank   NZ_AP025877
Plasmid name   pFJMB80153_2 Incompatibility group   ColRNAI
Plasmid size   4760 bp Coordinate of oriT [Strand]   898..957 [-]
Host baterium   Enterobacter hormaechei strain FUJ80153

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -