Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105852
Name   oriT_pFJMB80056_2 in_silico
Organism   Enterobacter hormaechei strain FUJ80056
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP025809 (271..329 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pFJMB80056_2
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6289 GenBank   NZ_AP025809
Plasmid name   pFJMB80056_2 Incompatibility group   ColRNAI
Plasmid size   2496 bp Coordinate of oriT [Strand]   271..329 [+]
Host baterium   Enterobacter hormaechei strain FUJ80056

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -