Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105833 |
| Name | oriT_pD |
| Organism | Ligilactobacillus salivarius strain AR809 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084929 (487..540 [+], 54 nt) |
| oriT length | 54 nt |
| IRs (inverted repeats) | 16..23, 27..34 (TCCCCACA..TGTGGGGA) 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 54 nt
>oriT_pD
GTTGATACTATCAACTCCCCACAGTATGTGGGGACAGTTTCCCTTATGCTCTTT
GTTGATACTATCAACTCCCCACAGTATGTGGGGACAGTTTCCCTTATGCTCTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6270 | GenBank | NZ_CP084929 |
| Plasmid name | pD | Incompatibility group | - |
| Plasmid size | 2898 bp | Coordinate of oriT [Strand] | 487..540 [+] |
| Host baterium | Ligilactobacillus salivarius strain AR809 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |