Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105810
Name   oriT_UKMCC_1015|unnamed1 in_silico
Organism   Shigella sonnei strain UKMCC_1015
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060118 (4804..4863 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_UKMCC_1015|unnamed1
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6247 GenBank   NZ_CP060118
Plasmid name   UKMCC_1015|unnamed1 Incompatibility group   ColRNAI
Plasmid size   7231 bp Coordinate of oriT [Strand]   4804..4863 [-]
Host baterium   Shigella sonnei strain UKMCC_1015

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -