Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105806 |
Name | oriT_pMHMC-011 |
Organism | Shigella sonnei strain 506 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP053762 (1230..1328 [-], 99 nt) |
oriT length | 99 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pMHMC-011
GGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
GGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 6243 | GenBank | NZ_CP053762 |
Plasmid name | pMHMC-011 | Incompatibility group | - |
Plasmid size | 1549 bp | Coordinate of oriT [Strand] | 1230..1328 [-] |
Host baterium | Shigella sonnei strain 506 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |