Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105806 |
| Name | oriT_pMHMC-011  |
| Organism | Shigella sonnei strain 506 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP053762 (1230..1328 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pMHMC-011
GGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
GGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6243 | GenBank | NZ_CP053762 |
| Plasmid name | pMHMC-011 | Incompatibility group | - |
| Plasmid size | 1549 bp | Coordinate of oriT [Strand] | 1230..1328 [-] |
| Host baterium | Shigella sonnei strain 506 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |