Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105778 |
| Name | oriT_ATCC 23378|unnamed  |
| Organism | Xanthomonas cucurbitae strain ATCC 23378 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP033327 (4733..4843 [+], 111 nt) |
| oriT length | 111 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 111 nt
>oriT_ATCC 23378|unnamed
CCGGCTGGCCCCGCAGGGCAGGATGCCCCGTTGAGCGCCGCAGGCGCGAATAAGGGGAAGTGAAGAGGATCACCGCGCTTGCGTGGTGGGCCTACTTCACACATCCTGCCC
CCGGCTGGCCCCGCAGGGCAGGATGCCCCGTTGAGCGCCGCAGGCGCGAATAAGGGGAAGTGAAGAGGATCACCGCGCTTGCGTGGTGGGCCTACTTCACACATCCTGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6215 | GenBank | NZ_CP033327 |
| Plasmid name | ATCC 23378|unnamed | Incompatibility group | - |
| Plasmid size | 14239 bp | Coordinate of oriT [Strand] | 4733..4843 [+] |
| Host baterium | Xanthomonas cucurbitae strain ATCC 23378 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |