Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105775
Name   oriT_p2_045001 in_silico
Organism   Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP043385 (1308..1366 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_p2_045001
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6212 GenBank   NZ_CP043385
Plasmid name   p2_045001 Incompatibility group   ColRNAI
Plasmid size   2496 bp Coordinate of oriT [Strand]   1308..1366 [+]
Host baterium   Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -