Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105774 |
| Name | oriT_Ka37751|unnamed1 |
| Organism | Klebsiella aerogenes strain Ka37751 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP041926 (42099..42151 [+], 53 nt) |
| oriT length | 53 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 53 nt
>oriT_Ka37751|unnamed1
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 6834..23238
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FPV33_RS25940 (FPV33_25070) | 2044..2676 | + | 633 | Protein_3 | hypothetical protein | - |
| FPV33_RS25075 (FPV33_25075) | 2776..3027 | + | 252 | WP_000121741 | hypothetical protein | - |
| FPV33_RS25080 (FPV33_25080) | 3017..3298 | + | 282 | WP_000638823 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| FPV33_RS25085 (FPV33_25085) | 3366..3665 | + | 300 | WP_000835764 | TrbM/KikA/MpfK family conjugal transfer protein | - |
| FPV33_RS25845 | 4666..4791 | + | 126 | WP_228717078 | TcpQ domain-containing protein | - |
| FPV33_RS25095 (FPV33_25095) | 5004..5264 | + | 261 | WP_267285557 | type IV pilus biogenesis protein PilM | - |
| FPV33_RS25910 | 5242..5349 | + | 108 | WP_247861726 | type IV pilus biogenesis protein PilM | - |
| FPV33_RS25945 | 5888..6184 | + | 297 | WP_338033512 | hypothetical protein | - |
| FPV33_RS25950 | 6202..6399 | + | 198 | WP_338033513 | hypothetical protein | - |
| FPV33_RS25955 | 6472..6763 | + | 292 | Protein_12 | conjugal transfer protein | - |
| FPV33_RS25115 (FPV33_25115) | 6834..7155 | + | 322 | Protein_13 | VirB3 family type IV secretion system protein | - |
| FPV33_RS25120 (FPV33_25120) | 7193..9521 | + | 2329 | Protein_14 | conjugal transfer protein | - |
| FPV33_RS25915 | 9838..10134 | + | 297 | WP_267285559 | VirB8/TrbF family protein | virB8 |
| FPV33_RS25920 | 10131..10418 | + | 288 | WP_267285558 | type IV secretion system protein | virB8 |
| FPV33_RS25135 (FPV33_25135) | 10485..11126 | + | 642 | WP_144235220 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| FPV33_RS25850 | 11741..12316 | + | 576 | WP_228717077 | TrbI/VirB10 family protein | virB10 |
| FPV33_RS25145 (FPV33_25145) | 12335..13435 | + | 1101 | WP_144235221 | P-type DNA transfer ATPase VirB11 | virB11 |
| FPV33_RS25150 (FPV33_25150) | 13411..15367 | + | 1957 | Protein_20 | type IV secretory system conjugative DNA transfer family protein | - |
| FPV33_RS25155 (FPV33_25155) | 15414..15950 | + | 537 | WP_001220543 | sigma 54-interacting transcriptional regulator | virb4 |
| FPV33_RS25160 (FPV33_25160) | 15943..17586 | + | 1644 | WP_001035592 | PilN family type IVB pilus formation outer membrane protein | - |
| FPV33_RS25165 (FPV33_25165) | 17637..18947 | + | 1311 | WP_001454111 | type 4b pilus protein PilO2 | - |
| FPV33_RS25170 (FPV33_25170) | 18931..19425 | + | 495 | WP_000912553 | type IV pilus biogenesis protein PilP | - |
| FPV33_RS25175 (FPV33_25175) | 19450..20988 | + | 1539 | WP_000466225 | ATPase, T2SS/T4P/T4SS family | virB11 |
| FPV33_RS25180 (FPV33_25180) | 20979..22088 | + | 1110 | WP_000974903 | type II secretion system F family protein | - |
| FPV33_RS25185 (FPV33_25185) | 22133..22690 | + | 558 | WP_000095048 | type 4 pilus major pilin | - |
| FPV33_RS25190 (FPV33_25190) | 22756..23238 | + | 483 | WP_001258095 | lytic transglycosylase domain-containing protein | virB1 |
| FPV33_RS25195 (FPV33_25195) | 23242..23877 | + | 636 | WP_000934977 | A24 family peptidase | - |
| FPV33_RS25200 (FPV33_25200) | 23890..25266 | + | 1377 | WP_089075442 | shufflon system plasmid conjugative transfer pilus tip adhesin PilV | - |
| FPV33_RS25960 (FPV33_25205) | 25263..25494 | - | 232 | Protein_31 | shufflon system plasmid conjugative transfer pilus tip adhesin PilV | - |
| FPV33_RS25230 (FPV33_25230) | 26625..27749 | + | 1125 | WP_000486716 | site-specific integrase | - |
Host bacterium
| ID | 6211 | GenBank | NZ_CP041926 |
| Plasmid name | Ka37751|unnamed1 | Incompatibility group | IncI2 |
| Plasmid size | 65845 bp | Coordinate of oriT [Strand] | 42099..42151 [+] |
| Host baterium | Klebsiella aerogenes strain Ka37751 |
Cargo genes
| Drug resistance gene | mcr-1.1, blaCTX-M-199 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |