Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105753
Name   oriT_AR_0365|unnamed4 in_silico
Organism   Enterobacter hormaechei subsp. hoffmannii strain AR_0365
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP027141 (4374..4433 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_AR_0365|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6190 GenBank   NZ_CP027141
Plasmid name   AR_0365|unnamed4 Incompatibility group   ColRNAI
Plasmid size   4604 bp Coordinate of oriT [Strand]   4374..4433 [+]
Host baterium   Enterobacter hormaechei subsp. hoffmannii strain AR_0365

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -