Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 105751
• Name: oriT_pCFSAN030807_8
• Organism: Shigella sonnei strain CFSAN030807
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP023653 (2595..2669 [-], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_pCFSAN030807_8
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 6188
• GenBank: NZ_CP023653
• Plasmid name: pCFSAN030807_8
• Incompatibility group: ColRNAI
• Plasmid size: 2690 bp
• Coordinate of oriT [Strand]: 2595..2669 [-]
• Host baterium: Shigella sonnei strain CFSAN030807

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -