Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105750
Name   oriT_pCFSAN030807_5 in_silico
Organism   Shigella sonnei strain CFSAN030807
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP023650 (5059..5133 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pCFSAN030807_5
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6187 GenBank   NZ_CP023650
Plasmid name   pCFSAN030807_5 Incompatibility group   ColRNAI
Plasmid size   5153 bp Coordinate of oriT [Strand]   5059..5133 [-]
Host baterium   Shigella sonnei strain CFSAN030807

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -