Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105746
Name   oriT_p75-02_7 in_silico
Organism   Shigella sonnei strain 75/02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP019695 (2240..2314 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_p75-02_7
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6183 GenBank   NZ_CP019695
Plasmid name   p75-02_7 Incompatibility group   ColRNAI
Plasmid size   2690 bp Coordinate of oriT [Strand]   2240..2314 [+]
Host baterium   Shigella sonnei strain 75/02

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -