Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105709 |
| Name | oriT_pYUSHP2-4  |
| Organism | Enterobacter hormaechei strain SH19PTE2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP073775 (3007..3064 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pYUSHP2-4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6146 | GenBank | NZ_CP073775 |
| Plasmid name | pYUSHP2-4 | Incompatibility group | ColRNAI |
| Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 3007..3064 [+] |
| Host baterium | Enterobacter hormaechei strain SH19PTE2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |