Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105686 |
| Name | oriT_pBD-50-Eh_3  |
| Organism | Enterobacter hormaechei subsp. steigerwaltii strain BD-50-Eh |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP063226 (31000..31094 [-], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pBD-50-Eh_3
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6123 | GenBank | NZ_CP063226 |
| Plasmid name | pBD-50-Eh_3 | Incompatibility group | IncFIA |
| Plasmid size | 88821 bp | Coordinate of oriT [Strand] | 31000..31094 [-] |
| Host baterium | Enterobacter hormaechei subsp. steigerwaltii strain BD-50-Eh |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkF, mrkD, mrkC, mrkB, mrkA |
| Metal resistance gene | arsD, arsA, arsB, arsC, pcoE, chrF, chrC, chrA, arsR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |